Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences
نویسنده
چکیده
Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC_020557; Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090> 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846> 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organism's transcriptome is related to its cellular proteome.
منابع مشابه
Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences
Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research,...
متن کاملComplete genome sequence of the 2,3-butanediol-producing Klebsiella pneumoniae strain KCTC 2242.
Here we report the full genome sequence of Klebsiella pneumoniae KCTC 2242,consisting of a 5.26-Mb chromosome (57.6% GC%; 5,035 genes [4,923 encoding known proteins, 112 RNA genes]) and a 202-kb plasmid (50.2% GC%; 229 genes [229 encoding known proteins]).
متن کاملMechanism of translational coupling in the nifLA operon of Klebsiella pneumoniae.
The nifLA operon of Klebsiella pneumoniae encodes the sensor-activator pair involved in the regulation of other nif genes. Balanced synthesis of both proteins, which is required for correct regulation, is achieved by coupling translation of nifA to that of nifL. The mechanism of translational coupling at the nifLA operon was analysed using a specialized ribosome system, and the effect of substi...
متن کاملAbsence of Escherichia coli, Listeria monocytogenes, and Klebsiella pneumoniae antigens within inflammatory bowel disease tissues.
BACKGROUND Escherichia coli, listeria, and streptococcal antigens have been found in Crohn's disease tissues. Antibodies to Klebsiella pneumoniae have been found in patients with inflammatory bowel disease and ankylosing spondylitis. The presence of these bacterial antigens in Crohn's granulomas would be of aetiological interest, while their presence in ulcers alone would be more likely to indi...
متن کاملAntibacterial activity of pollen and propolis extracts
The antimicrobial activities of different concentrations of pollen and propolis extracts were determined against nine food-borne pathogens (Streptococcus salivarius RSHE 605, Listeria monocytogenes NCTC 5348, Staphylococcus aureus ATCC 25923, Salmonella enteritidis ATCC 13076, Staphylococcus pneumoniae ATCC 10015, Escherichia coli ATCC 25922, Klebsiella pneumoniae NCTC 5049, Pseudomonas aerugin...
متن کامل